First Report of Grapevine yellow speckle viroid 1, Grapevine yellow speckle viroid 2, and Hop stunt viroid Infecting Grapevines (Vitis spp.) in Nigeria
Academic Article
Overview
Research
Identity
Additional Document Info
Other
View All
Overview
abstract
Grapevine yellow speckle viroid 1 (GYSVd-1), Grapevine yellow speckle viroid 2 (GYSVd-2; genus Apscaviroid), and Hop stunt viroid (HSVd; genus Hostuviroid) are three of six viroid species documented globally from grapevines (Di Serio et al. 2017). These small plant-pathogenic, non-protein coding, circular RNAs may or may not elicit disease symptoms in grapevines depending on vagaries of the environment and their presence in mixed infection with other grapevine-infecting viruses. During 2016, surveys were conducted in the Northern Guinea Savannah agroecological zone of Nigeria to document the occurrence of grapevine viruses and viroids. A total of 318 leaf tissue samples belonging to five cultivars were collected during the survey across 28 vineyards. The samples were dried under CaCl at room temperature, and then shipped under USDA-APHIS-PPQ permit to Texas A&M AgriLife Research and Extension Center, Weslaco, TX, for diagnosis. Equal amounts of leaf tissue were pooled together from all samples and distributed equally into two subsamples G1.1.164 and G2.1.165. Total nucleic acid (TNA) was isolated from each subsample using the MagMAX-96 viral RNA isolation kit (ThermoFisher Scientific), then used for cDNA library construction after a ribosomal RNA depletion step (TruSeq Stranded Total RNA with Ribo-Zero Plant kit, Illumina). Both libraries were sequenced on the Illumina NextSeq 500 platform, generating 39.7 and 24.2 million raw high-throughput sequencing (HTS) reads (76 nt in length) from samples G1.1.164 and G2.1.165, respectively. Analysis of the HTS reads resulted in the identification of 700/510 HSVd-specific, 1,854/1,239 GYSVd-1-specific, and 1,162/1,331 GYSVd-2-specific reads from samples G1.1.164/G2.1.165 along with reads specific to Grapevine leafroll-associated virus 1 in G2.1.165 (Zongoma et al. 2017). RT-PCR screening of 173 randomly selected field-collected samples with pairs of newly designed complete genome primers specific to HSVd (HSVd-nt254: 5-TTTGTCTATCTGAGCCTCTGC and HSVd-nt258: ACAAAAAGCAGGTTGGGACGAA), GYSVd-2 (GYSVd-2-nt2: 5-AAAGAAGAAGGGCCCAGA and GYSVd-2-nt258-237: CTTTTCTCTGCAGGTCCGC), and GYSVd-1 (Ward et al. 2011) revealed 34, 16, and 6% incidences of HSVd, GYSVd-1, and GYSVd-2, respectively. To further verify these results, complete genome fragments of all three viroid species were obtained from three samples and an additional HSVd-positive sample, all of cv. Queen Golden. The fragments were cloned individually into pCR2.1 TOPO-TA vector (Life Technologies, Carlsbad, CA) and two independent clones per amplicon were Sanger sequenced. In BLASTN analysis, complete genomes of HSVd derived in this study (296 to 303 nt; MF576417428) shared 96 to 100% identity with several HSVd GenBank isolates. The complete GYSVd-1 RNA derived in this study (365 to 367 nt; MF576399407) shared 96 to 99% identity with several GYSVd-1 GenBank isolates. The complete GYSVd-2 RNA derived in this study (361 nt; MF576408416) shared 97 to 99% identity with several GYSVD-2 GenBank isolates. No discernible symptoms were associated with the presence of all three viroid species in their source grapevines. To our knowledge, this is the first report of viroids infecting grapevine in Nigeria. Studies are ongoing to further elucidate the prevalence of all three viroids in Nigerian vineyards and their occurrences in mixed infections with other graft-transmissible agents of grapevine.
