First Report of Leaf Spot of Barley Caused by Drechslera gigantea in the United States Academic Article uri icon

abstract

  • 2017, American Phytopathological Society. All rights reserved. In December 2016 in Texas, extensive leaf spots (50% incidence with 2 to 8% leaf area affected) occurred on an experimental trial of barley (Hordeum secale var. Wintmalt) in Burleson County. The leaf spots were oval to elongated, 5 to 15 mm long, with a white to light brown center and a dark brown margin. Dematiaceous conidia 150 to 550 m long 15 to 18 m wide with 3 to 12 septa, borne singly on unbranched conidiophores, were observed in these lesions. Conidia had bipolar germination with multiple germ tubes. These features were consistent with Drechslera gigantea (Drechsler 1928). Leaf pieces were placed in 10% NaOCl for 30 s, washed twice with sterile, distilled water, and blotted dry with a paper towel. The margins of lesions (2 mm2) were plated on water agar with streptomycin (WA), and incubated at 25C. A fungus with dematiaceous mycelia was consistently isolated from plated lesions, which sporulated when transferred to WA plates with 2 to 3 surface-disinfested barley leaf pieces on the surface. Genomic DNA of the isolate TXBAR16 was extracted using a standard phenol chloroform protocol and the ITS region was amplified using ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers (White et al. 1990). The amplicon was cleaned using NEB (Ipswich, MA) Monarch PCR Clean and Concentrate Kit and sequenced at the Texas A&M University Gene Technology Lab (http://www.idmb.tamu.edu/gtl/). A comparison of GenBank using BLAST revealed 99% similarity to Bipolaris sp. 164.91 (GenBank AY004774.1). Zhang and Berbee (2001) previously demonstrated this strain, isolated as D. gigantea, to reside in the Cochliobolus clade with other Bipolaris species, rather than within the Pyrenophora clade where species of Drechslera are typically found. The amplicon sequence of the TXBAR16 isolate was deposited in GenBank as accession no. KY784633. The morphological match to the previous description as D. gigantea resulted in retention of that name here. To fulfill Kochs postulates, potted barley plants (var. Wintmalt), 10 to 15 cm tall, were inoculated in leaf whorls, either with V8 agar pieces or mycelial fragments grown on V8 broth. Three isolates were evaluated, as well as a noninoculated control, in a complete randomized design with four replicates of four plants per replicate. Plants were maintained in a mist chamber in a greenhouse at 18 to 24C and 100% relative humidity. The pathogenicity trial was repeated once. Leaf spots were first observed 4 to 5 days after inoculation and were prevalent after 7 days. All isolates were pathogenic. There were no symptoms on plants sprayed with sterile water. D. gigantea were consistently reisolated from symptomatic leaves, but not from controls, and produced characteristic conidia when transferred to WA with barley leaf pieces. D. gigantea was first described on bermudagrass (Cyandontis dactylon) in Texas (Heald and Wolf 1911) and it has since been observed on other grass hosts in the United States (Drechsler 1928). There was a symptomless bermudagrass pasture 90 m from the barley. Another barley variety in the trial, TAMbar 501, was not affected, nor were two varieties each of wheat and oats. The trial included several levels of N fertilization and the disease was much more pronounced at the lowest fertility. This appears to be a minor disease in Texas, but it may be overlooked, as the symptoms resemble scald. To our knowledge, this is the first report of this disease in the United States, previously reported only in Uruguay (Gamba and Tekauz 2003).

published proceedings

  • PLANT DISEASE

author list (cited authors)

  • Isakeit, T., Commer, B., Shaw, B. D., Brown, M., & Neely, C.

complete list of authors

  • Isakeit, T||Commer, B||Shaw, BD||Brown, M||Neely, C

publication date

  • January 1, 2017 11:11 AM